Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca ad 5

Próbowaliśmy ustalić, czy oddziaływanie Fk i CX3CR1 przyczynia się do uszkodzenia kłębuszkowego i śródmiąższowego w przyspieszonym modelu nefrotoksycznego zapalenia nerek u myszy. Jak zmierzono przez podwyższenie poziomu azotu mocznikowego we krwi, białkomocz i morfologię ilościową, uszkodzenie nerek było równie ciężkie w typie dzikim i CX3CR1 (3). myszy (tabela 1). Chociaż u samic wystąpił mniej uszkodzeń niż u mężczyzn, a nasilenie różniło się pomiędzy zwierzętami w każdej grupie, wszystkie zwierzęta wykazywały pewien stopień zapalenia kłębuszkowego i śródmiąższowego, gdy badano je 14 i 21 dni po immunizacji (tabela 1, figura 5). Poziom azotu mocznikowego we krwi był równie podwyższony od dnia 3 w obu grupach samców i samic myszy i był uporczywie podwyższony u mężczyzn w dniu 21 (Tabela 1). Continue reading „Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca ad 5”

Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca czesc 4

Nie wykazywały jawnych nieprawidłowości rozwojowych lub morfologicznych i były płodne. Kierowana delecja genu CX3CR1. Genomowy DNA potomka heterozygotycznych (+ / p) rodziców F2 przeszukiwano za pomocą zarówno analizy Southern blot, jak i PCR. (a) Southern blot. Tłumienie restrykcyjne endonukleazą Hindlll zostało sondowane fragmentem z 5. Continue reading „Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca czesc 4”

Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca cd

W odstępach od 3 do 21 dni po pierwszej dawce NTS uśmiercano grupy myszy (3 <4 / grupę), nerki zbierano, a krew pobierano przez nakłucie serca. Immunopatologia nerkowa. Połówki nerki utrwalono przez noc w 4 ° C w 10% obojętnej buforowanej formalinie, zatopiono w parafinie, podzielono na 4 .m i wybarwiono odczynnikiem Schiffa okresowym kwasem i trichromem Massona dla rutynowej histologii. Wszystkie oceny morfologiczne przeprowadzono w sposób zaślepiony z trzema lub czterema nerkami z każdej grupy w każdym punkcie czasowym, jak opisano (17). Patologię kłębuszkową oceniano, oceniając co najmniej 100 kłębuszków nerkowych na nerkę pod względem hiperkomórkowości, martwicy, hyalinozy, mikroanocząsteczek i tworzenia się sierpów. Continue reading „Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca cd”

Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca ad

Startery były następujące: krótkie ramię GCATCGATTGTCCACACTTTGGTCTTCC, GCGTCGACGGTGAGGTCCTGGAGGGGAAGG i długie ramię ATGGCGCGCCCATCAGATTTCCCTGCCGCT, ATGGCCGGCCGCTCCAGTGACAGGAAACTG. Przy użyciu miejsc restrykcyjnych kodowanych przez primer, krótkie i długie ramiona wklonowano do wektora pSV-Neo-TK (12) przy użyciu ClaI i SalI lub Asci i FseI. Wektor celujący CX3CR1 został linearyzowany i poddany elektroporacji do komórek ES RF8 i hodowany na komórkach karmiących STO produkujących czynnik hamujący białaczkę, jak opisano wcześniej (13). Klony oporne na G418 (150 .g / ml) i FIAU (0.25 .M) badano przesiewowo przez analizę Southern genomowego DNA strawionego Hindlll hybrydyzowanego z sondą zlokalizowaną 5 .l. wektora docelowego (Figura 1). Continue reading „Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca ad”

Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca

Fractalkine (Fk) jest strukturalnie nietypowym członkiem rodziny chemokin. Aby określić jego rolę w warunkach in vivo, uzyskaliśmy myszy z ukierunkowanym zakłóceniem CX3CR1, receptora dla Fk. CX3CR1. /. myszy były fenotypowo nie do odróżnienia od myszy typu dzikiego w środowisku wolnym od patogenów. Continue reading „Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca”

Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta ad 8

Oceniono następujące parametry: odsetek kłębuszków krwotocznych i sklerotycznych kłębuszków; i wynik zwłóknienia śródmiąższowego / śródmiąższowego. Zanik kanalików / zwłóknienie śródmiąższowe oceniono następująco: stopień 0, 0%> 24%; stopień 1, 25%. 49%; stopień 2, 50%. 74%; ocena 3, . 75%. Continue reading „Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta ad 8”

Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta ad 7

Macula densa, część dalszych kanalików, leży obok pozagałkowych komórek mezangialnych, a jądra komórek plamki żółtej są zlokalizowane apikalnie, co sugeruje możliwość wydzielania substancji (niebieskiego) z błony podstawnej z densą plamki żółtej. Należy zauważyć, że błona podstawna komórek plamki żółtej jest ciągła z błoną podstawną pozagałkowych komórek mezangialnych. (B) W Usag1 + / + Col4a3. /. myszy (WT / KO), komórki mezangium są aktywowane (purpurowe) i wydzielają MMP (nożyczki), które degradują GBM. Continue reading „Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta ad 7”

Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta ad 6

Ciężkie zwłóknienie kanalikowo-śródmiąższowe obserwuje się po uszkodzeniu kłębuszków nerkowych w Col4a3. /. myszy, a to pogarsza czynność nerek. Ponieważ Usag1. /. Continue reading „Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta ad 6”

Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta ad 5

Densa plamki jest częścią dalszych kanalików kontaktujących się ze swoim kłębuszkiem pochodzenia i sąsiadującym z komórkami mezangialnymi. Barwienie (C) a-Gal, jak również barwienie immunologiczne z przeciwciałem anty-LacZ, kolokalizowane za pomocą barwienia immunologicznego przeciwciałem anty-nNOS (marker dla plamki żółtej) w nerkach myszy Usag1 + / LacZ i myszy Bmp7 + / LacZ. Odcinek nerki od myszy WT był również traktowany w taki sam sposób, z odcinkami od myszy Usag1 + / LacZ i myszy Bmp7 + / LacZ i nie wykazywał żadnego wybarwienia p-galu. Pręty skali: 100 .m. (D) Analiza RT-PCR w czasie rzeczywistym mMNA MMP-12 w hodowanych komórkach mezangialnych leczonych zapalnie cytokinami. Continue reading „Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta ad 5”

Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta czesc 4

Poziomy fosforylacji Smad1 określono za pomocą systemu analizy obrazu LAS. Ostatnio kilka grup wykazało, że TGF-. aktywuje Smad1 / 5 oprócz Smad2 / 3 w komórkach śródbłonka poprzez nowe kompleksy receptorowe (32. 34). Tak więc postawiliśmy hipotezę, że zwiększona fosforylacja Smad1 / 5/8 w nerkach Usag1 + / + Col4a3. Continue reading „Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta czesc 4”