Mutacje receptora melanokortyny-4 są częstą i niejednorodną przyczyną chorobliwej otyłości ad

Otyłość oceniano za pomocą BMI, Z-score (odchylenie standardowe w stosunku do średniego BMI dla danego wieku i płci dla francuskiej populacji referencyjnej), retrospektywnej historii masy ciała i poziomów leptyny. Metaboliczne powikłania otyłości oceniano na podstawie pomiarów węglowodanów, insuliny i lipidów. W przypadku niektórych pacjentów zmierzono skład ciała za pomocą absorpcjometrii biphotonowej (DXA, Hologic Inc., Waltham, Massachusetts, USA) i spoczynkowego tempa metabolizmu za pomocą kalorymetrii pośredniej (Deltatrac II MBM200; Datex-Ohmeda, Trappes, Francja). Próbki krwi wykonywano również po nocy w celu pomiaru hormonów. Dane kliniczne dotyczące 209 osób z otyłością i otyłością były następujące: płeć M / F = 50: 159, wiek 42. 12,0 zakres [12. 69], BMI = 51. 7,5 [32. 74], maksymalny osiągnięty BMI = 54. 8,5 kg / m2. Sześćdziesiąt (32%) było otyłych w okresie niemowlęcym, a 123 [64%] było otyłych w okresie dojrzewania. W podgrupie 91 osób ilościowe spożycie żywności zostało ocenione na podstawie historii żywienia przeprowadzonej przez specjalnie wyszkolonych dietetyków. Jakościowa ocena spożycia została przeprowadzona dla 187 probantów za pomocą kwestionariusza trójfaktorowego (TFEQ), instrumentu psychometrycznego opracowanego do badania zachowań żywieniowych (24). Ta autoquestionnaire z 51 pozycji mierzy trzy wymiary ludzkiego zachowania żywieniowego: powściągliwość, odhamowanie i głód. Ograniczone jedzenie (czynnik I, 21 elementów) definiuje się jako tendencję do ograniczania przyjmowania pokarmu w celu kontrolowania masy ciała. Odhamowanie (czynnik II, 16 pozycji) to niezdolność do oparcia się emocjonalnym i społecznym wskazówkom żywieniowym. Głód, czynnik III (14 pozycji) to subiektywne uczucie głodu. Badani wypełnili kwestionariusz dietetyczny przed przystąpieniem do badania zdrowia i badań dietetycznych. Dane dotyczące oceny ich aktywności fizycznej uzyskano również u 184 z 209 badanych przy użyciu kwestionariusza Baecke (25). Zbadano dwie grupy kontrolne nieotyłych osobników. W pierwszej grupie kontrolnej (kontrola 1, n = 254) wybrano losowo wybrane spośród 3000 osób uczestniczących we francuskim badaniu na temat skuteczności codziennej suplementacji witaminami i minerałami przeciwutleniającymi w zmniejszaniu poważnych problemów zdrowotnych i przyczyn przedwczesnej śmierci w duża populacja zdrowych ochotników (badanie SU-VI-MAX) (26). Druga grupa 112 nieotyłych, bez cukrzycy grup kontrolnych (kontrola 2) była małżonkami pacjentów z ugruntowanej, wcześniej opisanej grupy francuskich rodzin z cukrzycą typu 2 (23). W obu grupach kontrolnych, żaden z badanych nie osiągnął diagnostycznego punktu odcięcia dla otyłości (BMI> 30) (patrz tabela 2 dla charakterystyki przedmiotu). W grupie kontrolnej 2 7,5% badanych miało nadwagę (BMI, 27-30). Uzyskano świadomą zgodę wszystkich podmiotów, a protokoły zostały zatwierdzone przez Komitet Etyki Paryża (Hôtel-Dieu i Cochin). Genomowy DNA ekstrahowano z obwodowych leukocytów dla wszystkich osobników. Tabela 2Kliniczne i biologiczne fenotypy nosicieli mutacji MC4-R w porównaniu z populacjami skriningowymi PCR. Jednoniciowa konformacyjna analiza polimorfizmu. Część kodującą genu MC4-R amplifikowano za pomocą pięciu par primerów. Sekwencję (3-MSH3 kodującą gen POMC i każdy ekson hAGRP zamplifikowano za pomocą jednej pary primerów. Reakcje PCR przeprowadzono w objętości 25 .l zawierającej 1x GeneAmp PCR Buffer II przy użyciu polimerazy DNA AmpliTaq w obecności [32P] -dCTP. Pary starterów (5. 3.) I odwrotnych (5. 3.), Długość produktów PCR, temperatury hybrydyzacji i stężenie MgCl2 w reakcji PCR wskazano następująco: MCAF (ATCAATTCAGGGGGACACTG) / MCAR (CATGGGTGAATGCAGATTCT) , MCBF (GTGATTGTGGCAATAGCCAA) / MCBR (TCCACTGCAATTGAAAGCAG) MCCF (TGTAGCTCCTTGCTTGCATC) / MCCR (GGCCATCAGGAACATGTGGA) MCDF (ACCATGTTCTTCACCATGCTG) / MCDR (GAGACATGAAGCACACACAA) MCEF (CCATTCTTCCTCCACTTAAT) / MCer (TGCATGTTCCTATATTGCGTG), 55 ° C, 1,5 mm; POMCF (GAAGACTGCGGCCCGCTGCCT) / POMCR (CGTCATCGGCAGGGCCGTCG), 65 ° C, 1,5 mM (10% DMSO); ARTAF (TCTTCCTGCTGAGCCAG) / ARTAR (GTCCCACCCTTGCTCACACT), 65 ° C, 0,5 mM (2,5% formamid); ARTBF (CCTGCCCTCACATCCTCTG) / ARTBR (CCTTACCCTTTTCCCTGAGC), 65 ° C, 0,5 mM; ARTCF (GTGCTGGTTCCCCACCCCTG) / ARTCR (CCTACCCTAGCCCCGACCCT), 65 ° C, mM (2,5% formamid). Znakowane radiologicznie produkty PCR rozcieńczono 1: 5 w buforze formamidowym i poddano elektroforezie w 5% żelu poliakryloamidowym nie zawierającym glicerolu i 10% (obj./obj.), Zawierającym glicerol, w ilości nie ulegającej kondensacji, odpowiednio w temperaturze pokojowej lub w temperaturze 4 ° C. Żele poddawano elektroforezie przy 6-20 W przez 4-7 godzin, suszono i poddawano autoradiografii przez noc. Klonowanie i sekwencjonowanie. Sekwencję wariantu najpierw określono przez reamplifikację produktu PCR i bezpośrednie sekwencjonowanie na ABI 377
[więcej w: przygotowanie do rektoskopii, balsam kapucyński ulotka, ból piszczeli po bieganiu ]
[przypisy: polana szymoszkowa basen, ile kalorii ma mozzarella, profilaktin koncentracja ]