Mutacje receptora melanokortyny-4 są częstą i niejednorodną przyczyną chorobliwej otyłości cd

Geny wariantu i typu dzikiego amplifikowano z genomowego DNA przy użyciu starterów MC4AF i MC4ER i klonowano do wektora ekspresyjnego pcDNA3 / MC4-R / V5 / His / Topo (Invitrogen, Carlsbad, California, USA). Analiza PCR-RFLP. Dla każdego wariantu, w którym stwierdzono mutację zmiany ramki odczytu lub missense, zaprojektowano test PCR-RFLP. Jednoniciowe startery polimorfizmu (SSCP) zastosowano do amplifikacji, gdy stwierdzono mutację wprowadzającą lub usuwającą miejsce restrykcyjne dla dostępnego w handlu enzymu restrykcyjnego. W przypadku innych mutacji, primery z niedopasowaniem sekwencji w 3. region zostały zaprojektowane w celu stworzenia sztucznych warunkowych miejsc restrykcyjnych mutacji. Zastosowany starter, jak również warunki PCR, są wskazane następnie, a następnie zastosowany enzym restrykcyjny, z niedopasowanymi zasadami podkreślonymi: mutacja ThrllSer, MCAF / MCAR, cięcie CaC8I (tylko cięcia mutantów); mutacja Arg18Cys, MCAF / MCAR, cięcie cięć AciI (tylko typu dzikiego [WT]); mutacja 47-48insG, (GCACACTTCTCTGCACCGCTG) / MCAR, cięcie MwoI (tylko cięcia WT); mutacja Val103Ile, MCBF / MC4RBB (TCTGTACTGTTTAATAGGGTGTTG), wyciąć HinCII (tylko WT [najczęstsze] cięcia); mutacja Thr150Ile, MC4RC0 (TTGCAGTGGACAGGTACGTTA) / MCCR, cięcie MaeIII (tylko cięcia WT); mutacja Ile170Val, MCCF / MC4RCx (GCAAGCTGCCCAGATACAAGTTA), cięcie MaeIII (tylko cięcia mutantów); mutacja Arg165Trp, MCCF / MCCR, cięcie AciI (tylko cięcia WT); mutacja Ile251Leu, MC4RD0 (GCGATTACCTTGACCAGCCTG) / MCDR pociętego CaC8I (tylko cięcia mutantów); mutacja Leu250Gln, MCDF / MC4RDy (GCAGACAACAAAGACGCCACTC), cięcie DdeI (tylko cięcia WT); mutacja Ile301Thr, MCEF / MC4RE0 (GTTCTTGACTCCGGAGTGCCTAA), cięcie DdeI (tylko cięcia mutantów). Aktywność MC4-R i test wiązania w stabilnie transfekowanych komórkach. Stabilne linie komórkowe zostały ustalone przez transfekcję komórek HEK 293 przy użyciu Effectene (QIAGEN, Hilden, Niemcy) i wybrane w mg / ml Geneticin (Life Technologies, Merelbecke, Niemcy) z klonowaną sekwencją potwierdzoną i dzikim typem i zmutowanym MC4-R. Aby uniknąć wahań klonalnych, w teście zastosowano pule stabilnych transformantów. Równoważną ekspresję receptora przez różne pule stabilnie transformowanych komórek oceniano metodą Northern blot. Test aktywacji receptora melanokortyny został zaadaptowany z Lu i in. (27) przy użyciu pCRE / lucyferazy (pCRE-luc) (28), indukowalnego cAMP plazmidu ekspresjonującego lucyferazę. Stabilne linie komórkowe wyrażające dziki typ lub różne zmutowane receptory transfekowano pCRE-luc stosując Exgen 500 (Euromedex, Souffel Weyershiem, France). Pięć mikrogramów DNA pCRE-luc zastosowano do transfekcji 10-cm naczynia z komórkami. W 24 godziny po transfekcji komórki podzielono na jedną 48-studzienkową płytkę i inkubowano w MEM. średni. 48 godzin po transfekcji komórki przemyto i inkubowano w pożywce do stymulacji (podłoże MEMa zawierające 0,1 mg / ml BSA i 0,25 mM 3-izobutylo-l-metyloksantyny) i stymulowano różnymi stężeniami a-MSH (Sigma Chemical Co., St. Louis, Missouri, USA) przez 6 godzin w temperaturze 37 ° C w inkubatorze z 5% CO2. Komórki stymulowano również mM 8Br-cAMP w celu normalizacji pod kątem wydajności transfekcji. Po stymulacji komórki poddano lizie w 300 ul buforu do lizy (25 mM glygly, 15 mM MgSO4, 4 mM EGTA, mM DTT, 1% Triton), zamrożono i rozmrożono, a następnie testowano na aktywność lucyferazy za pomocą Luciferase Reporter 1000 Assay System (Promega, Madison, Wisconsin, USA) w luminometrze zalecanym przez producenta. Aktywność lucyferazy normalizowano do stężenia białka i prezentowano jako krotność stymulowanego poziomu 8Br-cAMPa w celu normalizacji pod kątem wydajności transfekcji konstruktu pCRE-luc. Dane oznaczają średnie i odchylenie standardowe od pięciu punktów; Krzywe dopasowano za pomocą nieliniowej regresji przy użyciu oprogramowania JMP3 (SAS Institute Inc., Cary, North Carolina, USA). Doświadczenia wiązania wiązania przeprowadzono na stabilnych liniach komórkowych w następujący sposób: komórki wysiewano w ilości 5 x 105 komórek na studzienkę w 48-studzienkowych płytkach dzień przed eksperymentem wiązania. Komórki przemyto 200 .l podłoża wiążącego (1 mg / ml BSA w Ca2 + / Mg2 + PBS) i inkubowano w medium wiążącym 150-P L zawierającym 40 000. 60 000 cpm [125I] NDP-a MSH (NEN, Billerica, Massachusetts, USA). USA) na studzienkę. Do konkurowania ze znakowanym NDP-p MSH stosowano stężenie nieznakowanego a-MSH. Kontrole nieswoistego wiązania zawierały 10 yM nieznakowanego a-MSH. Po godzinie inkubacji ośrodek wiążący zasysano, komórki przemywano 400 .l ośrodka wiążącego i dodawano 200 .l 0,1 N NaOH. Liczby związane z błoną na minutę określono w liczniku gamma Cobra (Packard, Downers Grove, Illinois, USA). Całkowite specyficzne wiązanie i wartości IC50 określono za pomocą nieliniowej analizy regresji z trzech powtórzeń punktów danych przy użyciu oprogramowania Prism (GraphPad Software for Science, San Diego, Kalifornia, USA). Testy przejściowej ekspresji
[hasła pokrewne: profilaktin koncentracja, laserowe wybielanie zębów cena, tomaszowskie centrum zdrowia ]
[przypisy: paznokcie w kształcie migdałów, ból piszczeli po bieganiu, witamina c lewoskrętna wikipedia ]