Staphylococcus aureus aktywuje sygnalizację IFN typu I u myszy i ludzi poprzez powtórzone sekwencje Xr białka A czesc 4

Translokację zinternalizowanego SpA do cytosolu oceniano przez inkubację komórek nabłonka dróg oddechowych z białkiem fuzyjnym SpAa-laktamazy i oznaczanie aktywności .-laktamazy cytosolowej przy użyciu wcześniej opisanego układu reporterowego (27). SpA nie ulegał translokacji z pęcherzyków do cytosolu w badanym okresie czasu (30 minut do 4 godzin) (dane nie przedstawione). Inkubacja komórek dróg oddechowych za pomocą SpA Xr przez 2 godziny indukowane IFN-a transkrypcja; ta indukcja IFN-y transkrypcja w odpowiedzi na SpA Xr była znacząco zablokowana hamowaniem dynaminy (Figura 3C). Ponieważ te konstrukty zsyntetyzowano w postaci nadekspresjonowanych białek w Escherichia coli, przeprowadzono kilka eksperymentów kontrolnych, aby wykluczyć możliwość, że zanieczyszczające LPS wpłynęło na nasze doświadczenia. Jako jedną z kontroli, transfekowaliśmy komórki dróg oddechowych plazmidem eksprymującym SpA Xr lub kontrolą wektorową i udokumentowaliśmy 10-krotny wzrost IFN-y. Continue reading „Staphylococcus aureus aktywuje sygnalizację IFN typu I u myszy i ludzi poprzez powtórzone sekwencje Xr białka A czesc 4”

Sieć zależna od kwasu retinowego w przednim obiegu kontroluje tworzenie mysiego płuca czesc 4

Zastosowano dwa niezależne podejścia do zakłócenia sygnalizacji Wnt. Po pierwsze, przednie dziobki WT były leczone rekombinowanym mysim Dkk1, które wiąże się z receptorem Wnt Lrp5 / 6, co uniemożliwiało wiązanie się z Wnt (20). Alternatywnie, przedgry zostały poddane działaniu kwercetyny, flawonoidu, o którym wiadomo, że hamuje oddziaływanie pomiędzy Tcf i P-kateniną w jądrze (21). Prekursory płuc pochodzą z prymitywnego przedgrzybicy, jako grupa komórek endodermalnych tylnych do tarczycy, która eksprymuje homeoboks NK1 (Nkx2-1). Nkx2-1 jest najwcześniejszym znanym markerem losu komórek progenitorowych płuca, chociaż jest również wyrażany w tarczycy (22, 23). Continue reading „Sieć zależna od kwasu retinowego w przednim obiegu kontroluje tworzenie mysiego płuca czesc 4”

Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca ad

Startery były następujące: krótkie ramię GCATCGATTGTCCACACTTTGGTCTTCC, GCGTCGACGGTGAGGTCCTGGAGGGGAAGG i długie ramię ATGGCGCGCCCATCAGATTTCCCTGCCGCT, ATGGCCGGCCGCTCCAGTGACAGGAAACTG. Przy użyciu miejsc restrykcyjnych kodowanych przez primer, krótkie i długie ramiona wklonowano do wektora pSV-Neo-TK (12) przy użyciu ClaI i SalI lub Asci i FseI. Wektor celujący CX3CR1 został linearyzowany i poddany elektroporacji do komórek ES RF8 i hodowany na komórkach karmiących STO produkujących czynnik hamujący białaczkę, jak opisano wcześniej (13). Klony oporne na G418 (150 .g / ml) i FIAU (0.25 .M) badano przesiewowo przez analizę Southern genomowego DNA strawionego Hindlll hybrydyzowanego z sondą zlokalizowaną 5 .l. wektora docelowego (Figura 1). Continue reading „Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca ad”

Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta ad

Obserwacje w tym badaniu sugerują, że USAG-1 może przyczyniać się do patogenezy uszkodzenia nerek przez mechanizm, który uważamy za nowy, obejmujący przesłuch między plamką żółtą dystalnych kanalików i mezangium przynależnego kłębuszka nerkowego. Ponadto wykazujemy, że w nerce Col4a3. /. myszy, TGF-. sygnalizacja obejmuje fosforylację Smad1 / 5/8, czynniki transkrypcyjne klasycznie uważane za dalszy efekt sygnalizacji BMP. Continue reading „Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta ad”