Staphylococcus aureus aktywuje sygnalizację IFN typu I u myszy i ludzi poprzez powtórzone sekwencje Xr białka A czesc 4

Translokację zinternalizowanego SpA do cytosolu oceniano przez inkubację komórek nabłonka dróg oddechowych z białkiem fuzyjnym SpAa-laktamazy i oznaczanie aktywności .-laktamazy cytosolowej przy użyciu wcześniej opisanego układu reporterowego (27). SpA nie ulegał translokacji z pęcherzyków do cytosolu w badanym okresie czasu (30 minut do 4 godzin) (dane nie przedstawione). Inkubacja komórek dróg oddechowych za pomocą SpA Xr przez 2 godziny indukowane IFN-a transkrypcja; ta indukcja IFN-y transkrypcja w odpowiedzi na SpA Xr była znacząco zablokowana hamowaniem dynaminy (Figura 3C). Ponieważ te konstrukty zsyntetyzowano w postaci nadekspresjonowanych białek w Escherichia coli, przeprowadzono kilka eksperymentów kontrolnych, aby wykluczyć możliwość, że zanieczyszczające LPS wpłynęło na nasze doświadczenia. Jako jedną z kontroli, transfekowaliśmy komórki dróg oddechowych plazmidem eksprymującym SpA Xr lub kontrolą wektorową i udokumentowaliśmy 10-krotny wzrost IFN-y. Continue reading „Staphylococcus aureus aktywuje sygnalizację IFN typu I u myszy i ludzi poprzez powtórzone sekwencje Xr białka A czesc 4”

Sieć zależna od kwasu retinowego w przednim obiegu kontroluje tworzenie mysiego płuca cd

Zwiększenie poziomu Dkk1 nie było ograniczone do przypuszczalnego pola płuc, ale było konsekwentnie widoczne w tym miejscu (Figura 1, J. M, obszary pudełkowe). Dane silnie sugerują, że ekspresja Dkk1 jest regulowana przez endogenny RA podczas organogenezy przedniego jelita i że ta regulacja może być funkcjonalnie odpowiednia dla pojawiającego się primordium płucnego. Dkk1 jest bezpośrednim celem RA w komórkach mezenchymalnych płuc. Aby uzyskać wgląd w mechanizm, dzięki któremu RA wpływa na ekspresję Dkk1, badaliśmy potencjalny bezpośredni wpływ RA w transkrypcji genu. Continue reading „Sieć zależna od kwasu retinowego w przednim obiegu kontroluje tworzenie mysiego płuca cd”

Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta

Błona podstawna kłębuszkowa (GBM) jest kluczowym składnikiem jednostki filtrującej w nerce. Mutacje obejmujące dowolny z genów kolagenu IV (COL4A3, COL4A4 i COL4A5) wpływają na montaż GBM i powodują zespół Alport, postępującą dziedziczną chorobę nerek bez ostatecznej terapii. Wcześniej wykazaliśmy, że antagonista morfogenetyczny białka kości (BMP), związany z wrażliwością na macicę związaną z genem (USAG-1), negatywnie reguluje działanie ochronne BMP-7 w mysim modelu uszkodzenia rurki podczas ostrej niewydolności nerek. Tutaj badaliśmy rolę USAG-1 w czynności nerek w Col4a3. /. Continue reading „Utrata antagonisty BMP USAG-1 łagodzi choroby w mysim modelu postępującej dziedzicznej choroby nerek Zespół Alporta”

Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca ad

Startery były następujące: krótkie ramię GCATCGATTGTCCACACTTTGGTCTTCC, GCGTCGACGGTGAGGTCCTGGAGGGGAAGG i długie ramię ATGGCGCGCCCATCAGATTTCCCTGCCGCT, ATGGCCGGCCGCTCCAGTGACAGGAAACTG. Przy użyciu miejsc restrykcyjnych kodowanych przez primer, krótkie i długie ramiona wklonowano do wektora pSV-Neo-TK (12) przy użyciu ClaI i SalI lub Asci i FseI. Wektor celujący CX3CR1 został linearyzowany i poddany elektroporacji do komórek ES RF8 i hodowany na komórkach karmiących STO produkujących czynnik hamujący białaczkę, jak opisano wcześniej (13). Klony oporne na G418 (150 .g / ml) i FIAU (0.25 .M) badano przesiewowo przez analizę Southern genomowego DNA strawionego Hindlll hybrydyzowanego z sondą zlokalizowaną 5 .l. wektora docelowego (Figura 1). Continue reading „Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca ad”