Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca ad

Startery były następujące: krótkie ramię GCATCGATTGTCCACACTTTGGTCTTCC, GCGTCGACGGTGAGGTCCTGGAGGGGAAGG i długie ramię ATGGCGCGCCCATCAGATTTCCCTGCCGCT, ATGGCCGGCCGCTCCAGTGACAGGAAACTG. Przy użyciu miejsc restrykcyjnych kodowanych przez primer, krótkie i długie ramiona wklonowano do wektora pSV-Neo-TK (12) przy użyciu ClaI i SalI lub Asci i FseI. Wektor celujący CX3CR1 został linearyzowany i poddany elektroporacji do komórek ES RF8 i hodowany na komórkach karmiących STO produkujących czynnik hamujący białaczkę, jak opisano wcześniej (13). Klony oporne na G418 (150 .g / ml) i FIAU (0.25 .M) badano przesiewowo przez analizę Southern genomowego DNA strawionego Hindlll hybrydyzowanego z sondą zlokalizowaną 5 .l. wektora docelowego (Figura 1). Ten test Southern był również używany do przesiewania linii myszy. Ponadto, zastosowano test PCR do przesiewania linii myszy zawierających wspólny 5. primer, AAGATAGGATGAGTGAAGAC i dwa 3. primery, TAC CGGTGGATGTGGAATGTGTGCG (gen neo) i GGTTGTTCATGGAGTTGGCGG (region kodujący CX3CR1). O ile nie wskazano inaczej, wszystkie myszy użyte w tych badaniach były hybrydami 50:50 szczepów C57BL / 6 i 129 / Sv. Rysunek Przekierowywanie wektora dla genu CX3CR1. Górna linia pokazuje częściową mapę restrykcyjną locus CX3CR1 wskazującą miejsca rozpoznawane dla Hindlll (H) i PstI (P). Wektor celujący jest pokazany pośrodku, a przewidywana struktura docelowego allelu po rekombinacji homologicznej jest pokazana poniżej. Region kodujący dla CX3CR1 jest wskazany przez gruby pasek. Gen neo jest flankowany przez miejsca loxP do usunięcia. Wskazano także lokalizacje starterów PCR i sondę stosowaną do badania przesiewowego komórek ES i myszy. Adhezja leukocytów krwi obwodowej do barwienia Fk i Ab. Leukocyty krwi obwodowej izolowano zgodnie z opisem (14). W skrócie, krew pobrano z dolnej żyły dolnej myszy lekko znieczulonej i odwirowano przy 100 g przez 30 minut. Czerwone krwinki usunięto za pomocą hipotonicznej lizy (155 mM NH4Cl, 10 mM KHCO3, 100 uM EDTA) przez 15 minut, a komórki przemyto buforem testowym. W niektórych doświadczeniach komórki NK i komórki T oczyszczano przed testem adhezji. Zawiesiny komórkowe ze śledziony i węzłów chłonnych (pachwinowych i pachowych) połączono i przepuszczono przez sitka 70-.m (Falcon, Becton Dickinson Labware, Franklin Lakes, New Jersey, USA) i przemyto HBBS uzupełnionym 1% FCS (obj./obj. vol) i 1% HEPES (10 mM). Czerwone komórki lizowano przez hipotoniczną lizę, płukano buforem do barwienia (PBS plus 1% FCS i 0,1% NaN3) i zawieszano ponownie w stężeniu 106 komórek / ml. Komórki barwiono NK1.1 Ab (phycoerythrin, 0,25 .g / ml) i CD3 (sprawny, 0,25 .g / ml) (PharMingen, San Diego, Kalifornia, USA) przez 30 minut w 4 ° C, przemyto dwukrotnie z buforem do barwienia i ponownie zawieszony przy końcowym stężeniu 15 x 106 komórek / ml do sortowania w sortowniku komórek FacsVantage (Becton Dickinson, Mountain View, Kalifornia, USA). Statyczne testy adhezji przeprowadzono w sposób opisany uprzednio (15). Komórki przyklejono do szkiełka za pomocą wirówki Cytospin (Shandon Lipshaw, Pittsburgh, Pensylwania, USA), przy 17,9 g przez 3 minuty. Zarówno komórki przylegające do Fk, jak i cytospunkowe znakowano sprzężonym z biotyną pierwszorzędowym Ab: chomiczem anty-CD3, szczurzym anty-CD11b i szczurzym anty-Ly-6G (rozcieńczenie 1: 200 w 100 ul buforu do znakowania, PBS z 1% BSA i 0,1% azydku sodu, 30 minut na lodzie) (PharMingen). Skrawki przemyto dwukrotnie buforem do znakowania i inkubowano ze streptawidyną-FITC (20 minut na lodzie). Preparaty przemyto i inkubowano w 3% paraformaldehydzie (przez 5 minut) i oglądano za pomocą odwróconego mikroskopu TE-300 (Nikon, Tokio, Japonia) za pomocą cyfrowej kamery diagnostycznej SPOT RT (Diagnostic Instruments, Sterling Heights, Michigan, USA). Diagnostyczne oprogramowanie do obrazowania SPOT oraz oprogramowanie Twain dla Windows 95/98 / NT. Zdjęcia przygotowano za pomocą programu PhotoShop 5.5 (Adobe Systems Inc., Santa Clara, Kalifornia, USA) i narzędzia do analizy obrazu IPTK 3.0 (gry Reindeer, Ashville, Karolina Północna, USA). Indukcja zapalenia nerek. Owce immunizowano lizatem kłębuszków wytworzonych z nerki szczura Sprague-Dawley, jak opisano (16). Nefrotoksyczną surowicę (NTS) inaktywowano termicznie w 56 ° C przez 45 minut, absorbowano przez noc czerwonymi krwinkami myszy i sterylizowano przez przepuszczenie przez filtr 0,2-.m przed użyciem. Myszy trzykrotnie krzyżowano wstecznie z tłem genetycznym CD1. Mężczyzna i kobieta CX3CR1 + / + i CX3CR1. /. myszy (samce. 35 gi kobiety. 23 g) uczulano przez podskórne wstrzyknięcie 200. g normalnego owczego IgG w CFA w podzielonych dawkach w każdym boku. Począwszy od 5 dni później myszy otrzymywały codzienne zastrzyki NTS (mężczyźni: 50 ul, kobiety: 30 ul) przez 3 dni; myszy kontrolne otrzymały równoważne dawki normalnej surowicy owczej
[podobne: balsam kapucyński ulotka, centrum onkologii warszawa roentgena, pompa insulinowa refundacja ]
[przypisy: podkolanówki kompresyjne, odchudzanie roku vita slim opinie, balsam kapucyński ulotka ]