Ukierunkowana delecja CX3CR1 ujawnia rolę fraktalkiny w odrzucaniu aloprzeszczepu serca

Fractalkine (Fk) jest strukturalnie nietypowym członkiem rodziny chemokin. Aby określić jego rolę w warunkach in vivo, uzyskaliśmy myszy z ukierunkowanym zakłóceniem CX3CR1, receptora dla Fk. CX3CR1. /. myszy były fenotypowo nie do odróżnienia od myszy typu dzikiego w środowisku wolnym od patogenów. W odpowiedzi na indukowane przeciwciałem zapalenie kłębuszków nerkowych, CX3CR1a / r. a myszy CX3CR1 + / + miały podobny poziom białkomoczu i uszkodzenia. CX3CR1. /. i myszy CX3CR1 + / + również rozwinęły podobny poziom choroby w wywołanym glikoproteiną mieliny indukowanym glikoproteiną eksperymentalnym autoimmunologicznym zapaleniem mózgu i rdzenia. Przeprowadzono heterotopowe transplantacje serca klasy I / II MHC od myszy BALB / c do myszy C57BL / 6. W nieobecności cyklosporyny A (CsA) nie było różnicy w czasie przeżycia przeszczepu między CX3CR1 a /. i myszy biorców CX3CR1 + / +. Jednakże, w obecności subterapeutycznych poziomów CsA, czas przeżycia przeszczepu był istotnie zwiększony w CX3CR1 (3). myszy. Charakterystyka komórek infiltrujących przeszczepy ujawniła selektywną redukcję w naturalnych komórkach NK w CX3CR1 (3). biorcy pod nieobecność CsA i zmniejszenie makrofagów, naturalnych komórek zabójczych i innych leukocytów w obecności CsA. Wnioskujemy, że Fk odgrywa ważną rolę w odrzucaniu przeszczepu. Rozwój antagonistów CX3CR1 może pozwolić na zmniejszenie dawek leków immunosupresyjnych stosowanych w transplantacji. Wprowadzenie Fractalkine (Fk) jest niezwykłym członkiem rodziny chemokin cytokin chemotaktycznych i ma właściwości strukturalne i funkcjonalne, które nie zostały znalezione wcześniej w rodzinie chemokin. Strukturalnie, podobna do chemokiny domena Fk jest połączona z szyjką mucyny i domeną transbłonową, umieszczając ją na powierzchni komórki, gdzie może skutecznie oddziaływać z innymi komórkami, takimi jak krążące leukocyty. Funkcjonalnie, Fk może skutecznie wychwytywać komórki poprzez bezpośrednią interakcję z pokrewnym receptorem, CX3CR1, i tym samym działa jako skuteczna cząsteczka adhezyjna (1. 4). Niedawno doniesiono o innej chemokinie (CXCL16) o podobnej niezwykłej architekturze (5). Fk, który u myszy jest znany jako neurotaktyna, ulega ekspresji na powierzchni aktywowanych komórek śródbłonka w układzie naczyniowym i na neuronach w OUN, gdzie wydaje się, że bierze udział w regulacji aktywności mikrogleju (1, 6). Jest on regulowany w górę przez prozapalne cytokiny i lipopolisacharyd i jest uwalniany jako rozpuszczalne białko, prawdopodobnie w wyniku potranslacyjnego cięcia (1, 4, 7, 8). Rozpuszczalny Fk jest tak silnym chemoatraktantem, jak inni członkowie rodziny chemokin (2). Ostatnie dane sugerują potencjalne role Fk w kłębuszkowym zapaleniu nerek, odpowiedź mikrogleju na uszkodzenie neuronów i zapalenie śródbłonka serca (7, 9. 11). Aby dostarczyć bardziej ostateczne dane na temat roli Fk in vivo, wykorzystaliśmy rekombinację homologiczną w embrionalnych komórkach macierzystych (ES), aby wytworzyć myszy z niedoborem CX3CR1. W środowisku wolnym od patogenów myszy pozbawione CX3CR1 były żywe, płodne i nieodróżnialne od miotów z rodzaju dzikiego. Badanie krwinek obwodowych wykazało, że CX3CR1 odgrywa kluczową i niebędącą ilością rolę w adhezji komórek jednojądrzastych do unieruchomionego Fk. Pomimo znacznej ekspresji w OUN, nie znaleźliśmy dowodów na wady rozwojowe lub jakiekolwiek różnice w nasileniu choroby między CX3CR1 + / + i CX3CRI. /. myszy w wywołanym glikoproteiną myelinowym indukowanym glikoproteiną. (indukowanym MOG) doświadczalnym autoimmunologicznym zapaleniem mózgu i rdzenia (EAE). Podobnie, nie znaleźliśmy żadnej różnicy w ostrym zapaleniu nerek wywołanym przez antyserum anty-kłębuszkową błonę podstawną. Jednak w mysim modelu przeszczepienia serca immunosupresyjny CX3CR1. /. biorcy mieli dramatyczne wydłużenie przeżycia przeszczepu. Badania te dostarczają mocnych dowodów na rolę Fk w chorobie naczyniowej z udziałem układu odpornościowego. Metody Generowanie CX3CR1. /. myszy. Biblioteka bakteryjnego sztucznego chromosomu (BAC) z Research Genetics (Huntsville, Alabama, USA) została przebadana pod kątem mysiego genu CX3CR1 za pomocą PCR. Zastosowane startery były następujące: GTCCTCGCCCTCACCAACAGC i TTGAGAGTCTCCAGGAAAATCA. Zidentyfikowano BAC zawierający CX3CR1 (płytka 52, K17). Mapowanie restrykcyjne regionu zawierającego CX3CR1 śledzono przez subklonowanie fragmentów SacI i Xbal, zawierających gen CX3CR1 i sekwencje flankujące. Fragmenty te subklonowano do wektora wahadłowego i końce sekwencjonowano. Z tej informacji o sekwencji zaprojektowano startery do amplifikacji krótkiego ramienia o długości 2,3 kb i długiego ramienia o długości 5,9 kb z fragmentów SacI i Xbal. Zastosowano zestaw Long PCR (Roche Molecular Biochemicals, Indianapolis, Indiana, USA), a startery zaprojektowano z restrykcyjnymi miejscami nukleazy dodanymi na końcach
[podobne: przygotowanie do rektoskopii, balsam kapucyński ulotka, olej lniany na odchudzanie ]
[podobne: centrum onkologii warszawa roentgena, kamikadze, rak płaskonabłonkowy płuca ]