Wydzielone białko 4 związane z białkami szprotu jest silnym czynnikiem fosfatycznym pochodzenia nowotworowego ad

Obecnie donosimy, że sFRP-4 jest silnym środkiem regulującym fosforany in vitro i in vivo oraz że działa niezależnie od PTH. Ponadto, sFRP-4 zakłóca kompensacyjny wzrost stężenia donorowego RNA RNA 25-hydroksywitaminy D1 hydroksylazy cytochromu P450 i stężenia 1, 25, 25-dihydroksywitaminy D w surowicy typowo obserwowane w odpowiedzi na hipofosfatemię. Aby określić, czy sFRP-4 jest rzeczywiście czynnikiem krążącym, jak to jest charakterystyczne dla fosfatoniny, mierzyliśmy i wykrywaliśmy sFRP-4 w prawidłowej surowicy ludzkiej oraz w surowicy pacjenta z TIO. Co więcej, wykazujemy, że sFRP-4 działa jako antagonista sygnalizacji Wnt w nerkach, ponieważ podawanie sFRP-4 in vivo jest związane ze zmniejszeniem całkowitej (3-ketenyny i wzrostem fosforylowanej (3-kateniny w tkankach nerkowych. Nasze dane pokazują, że sFRP-4 może potencjalnie funkcjonować jako fosfatyna. Zatem nowotwory związane z osteomalacją wytwarzają co najmniej dwa czynniki fosfatycz- ne, FGF-23 i sFRP-4. Metody Synteza i oczyszczanie sFRP-4. Pulę cDNA zsyntetyzowano z guza TIO przy użyciu zestawu do syntezy cDNA Lambda ZAP-CMV (Stratagene, La Jolla, Kalifornia, USA) (22, 23). Pełnej długości ludzkie cDNA sFRP-4 zawierające otwartą ramkę odczytu minus kodon stop został amplifikowany z puli cDNA przy użyciu sensownego primera 5. GCAGTGCCATGTTCCTCTCCATCC3. i antysensowny starter 5. CACTCTTTTCGGGTTTGTTCTC3. i polimerem Taq DNA o wysokiej wierności (Invitrogen Corp., Carlsbad, California, USA) (22, 23). Amplikon sklonowano w ramce z epitopami V5-His do pcDNA3.1-V5-His / TOPO (Invitrogen Corp.) lub wektora owadziego pIB / V5-His (Invitrogen Corp.) (22, 23) i wierności sekwencji zostało potwierdzone (Sequegen Co., Worcester, Massachusetts, USA). BTI-TN-5B1-4 (wysoka piątka) Komórki owadzie Trichoplusia niosły się stabilnie za pomocą pIB / V5-His-sFRP-4 i hodowano w pożywce bez surowicy Express Five uzupełnionej 90 ml 200 mM L-glutaminy na litr ( Invitrogen Corp.) i Blasticidin S do selekcji i konserwacji kultur podstawowych w butelkach o pojemności 75 cm2 (Invivogen Inc., San Diego, California, USA). W celu ekspresji sFRP-4 na dużą skalę, 2-litrową kolbę Ehrlenmeyera zawierającą 0,5 l pożywki Express Five inokulowano około 0,5 x 106 do x 106 komórek / ml i hodowano w 27 ° C i 120 obr / min w temperaturze Innova 4330 kontrolowany inkubator wibracyjny (New Brunswick Scientific Co. Inc., Edison, New Jersey, USA). Kondycjonowaną pożywkę otrzymano po 5. 6 dniach wzrostu hodowli (końcowa gęstość komórek około 0,4 × 107 do × 107 komórek / ml). Wydzielony FRP-4 adsorbowano z filtrowanej kondycjonowanej pożywki do 25 ml żywicy SP Sepharose (Amersham Biosciences, Piscataway, New Jersey, USA) przez około 12 godzin w temperaturze 4 ° C z mieszaniem. Żywicę partiami przemywano kolejno cztery razy z każdym buforem, stosując 10 objętości 20 mM Na2HPO4 (pH 7,4), 65 mM NaCl (bufor początkowy), a następnie 20 mM Na2HPO4 (pH 7,4) i 200 mM NaCl (bufor pośredni). . Wydzielony FRP-4 eluowano trzema przemyciami 50 ml 20 mM Na2HPO4 (pH 7,4) i M NaCl. Eluat poddano dializie do 500 ml buforu startowego w 4 ° C przy użyciu rurki do dializy Spectra / Por 7 (1000 cięć cząsteczkowych; Spectrum Medical Industries, Laguna Hills, Kalifornia, USA) z trzema zmianami buforu. Dializat przefiltrowano (0,2 .m, 25 mm filtr strzykawkowy z nylonu, Nalge Co., Rochester, New York, USA) i naniesiono na kolumnę Hi Prep 16/10 FF SP Sepharose, stosując szybko działające białko ATK do chromatografii cieczowej ĘKTA. system oczyszczania (Amersham Biosciences). Wydzielone białko FRP-4 eluowano stosując zaprogramowany gradient elucyjny zaczynając od 20 mM Na2HPO4 (pH 7,4), 65 mM NaCl, a kończąc na 20 mM Na2HPO4 (pH 7,4), 1,0 M NaCl. Frakcje zawierające sFRP-4 zidentyfikowano za pomocą analizy immunoblot anty-V5, zatężono przy użyciu Centriprep 10 (Amicon, Beverly, Massachusetts, USA) i sterylnie przesączono stosując 0,2-.m nylonowe filtry strzykawkowe. Wydzielane białko FRP-4 miało oczekiwaną N-końcową sekwencję aminokwasów (APC / XEAV). Wpływ sFRP-4 na transport fosforanów w komórkach OK. Komórki OK hodowano w 45% DMEM, 45% pożywki F12, z 10% FCS. Komórki wysiano z gęstością około 5 x 103 na studzienkę w 24-dołkowych płytkach do hodowli tkankowej i zależnym od sodu fosforanem, alaniną i kotransportem glukozy mierzono jak opisano wcześniej (2, 12). W skrócie, dodano sFRP-4 lub zaróbkę w różnych ilościach do pożywki wzrostowej w celu uzyskania stężeń pokazanych na Figurze 1. Do pomiaru zależnego od sodu transportu fosforanu, 0,1 mM dwuzasadowy fosforan potasu był zawarty w pożywce transportowej, a 32P dwuzasadowy potas. fosforan dodano do końcowej specyficznej aktywności 2 CiC / ml
[hasła pokrewne: paznokcie w kształcie migdałów, witamina c lewoskrętna wikipedia, tomaszowskie centrum zdrowia ]
[przypisy: przygotowanie do rektoskopii, centrum onkologii warszawa roentgena, kamikadze ]