Wydzielone białko 4 związane z białkami szprotu jest silnym czynnikiem fosfatycznym pochodzenia nowotworowego czesc 4

Stężenia wapnia w surowicy i moczu określono metodą atomowej spektrometrii absorpcyjnej. Stężenie osoczu a, 25-dihydroksywitaminy D i 25-hydroksywitaminy D mierzono za pomocą testu immunologicznego (Diasorin Inc., Stillwater, Minnesota, USA). Cykliczny monofosforan adenozyny w moczu został zmierzony przy użyciu testu immunoenzymatycznego (Amersham Biosciences). Real-time PCR do oceny stężenia cytochromu P450 25-hydroksywitaminy D hydroksylazy i 24-hydroksylazy 24-hydroksylazy RNA cytochromu P450 w nerce. Polytron (Brinkman Instruments, Westbury, New York, USA) użyto do homogenizacji bocznej trzeciej każdej nerki szczura zawierającej tkankę korową w 4 ml buforu RLT (QIAGEN Inc., Valencia, Kalifornia, USA). Homogenat wirowano przez 3 minuty przy 4500 g. Całkowity RNA ekstrahowano z supernatantu po traktowaniu DNazą za pomocą zestawu RNeasy midi (QIAGEN Inc.). Stężenie RNA w próbkach oznaczono ilościowo za pomocą spektroskopii UV przy długości fali 260 nm. Próbki zawierające 200 ng całkowitego RNA przygotowano przy użyciu zestawu Quantitect SYBR Green RT-PCR (QIAGEN Inc.) i PCR w czasie rzeczywistym wykonanym zgodnie z protokołem producenta na detektorze sekwencji PE Applied Biosystems model 7700 (PE Applied Biosystems, Foster City , Kalifornia, USA). Startery zaprojektowano tak, aby obejmowały introny i generowały amplikony o wielkości 100-120 pz. Sekwencje starterów są następujące: 25-hydroksylaza 25-hydroksywitaminy D cytochrom P450 (do przodu, 5. GCAT CCATCTCCAGTTTGTAGAC3 ., do tyłu, 5. TGTGCCTCTTGTGCATAGTAAGA3.); 25-hydroksywitamina D 24-hydroksylaza, cytochrom P450 (do przodu, 5 (3 GATCACCTTTCCAAGAAGGAACT3 (3 do tyłu, 5 (AGAGAATCCACATCAAGCTGTTC3 a); i zależny od sodu kotransporter fosforanowy IIa (do przodu, 5-CTGTGCACTTGTCTTATCCTCCT3 (3, odwrotny 5-GGAAGTCTGTGTTGATGACCT3). Zaprojektowano długie szablony oligonukleotydowe, które reprezentowały całą sekwencję amplikonu dla każdego genu, przy czym rozcieńczenia zostały użyte do wygenerowania standardowych krzywych. Wszystkie próbki przebadano w trzech powtórzeniach, a średnie każdego z nich znormalizowano do GAPDH. Wartości mRNA GAPDH nie różniły się znacząco w próbkach. Normalizowanym wartościom względnym przypisano wartości bezwzględne na podstawie nachylenia i punktu przecięcia z osią y odpowiedniej krzywej standardowej. Wszystkie produkty PCR, w tym negatywną kontrolę odwrotnej transkryptazy, i próbki kontrolne bez matrycy poddano elektroforezie na 4% żelu agarozowym. Wykryto tylko oczekiwane rozmiary pasm. ELISA dla sFRP-4 w surowicy. Sporządzono test ELISA typu sandwich dla dwóch osobników, stosując mAb (s. 3.1 i 3.4) przeciwko białku sFRP-4 pochodzącym z owadów. Te Ab zostały przygotowane w Zakładzie Podstawowym Kliniki Mayo przy użyciu ustalonych procedur (30). Pokrótce, mAb 3.4 unieruchomiono na płytce ELISA Reacti-Bind (Pierce Chemical Co., Rockford, Illinois, USA). Zrekombinowane standardy sFRP-4 w 100 .l PBS lub 100 .l próbek ludzkiej surowicy dodano do poszczególnych studzienek i inkubowano w temperaturze pokojowej przez godzinę. Próbki odessano i studzienki przemyto trzy razy PBS i 0,5% Tween-20. Drugie mAb anty-sFRP-4, mAb 3.1, biotynylowano sulfo-NHS-LC-biotyną (Pierce Chemical Co.), naniesiono na każdą studzienkę i inkubowano przez godzinę w temperaturze pokojowej. Próbki odessano i studzienki przemyto trzy razy PBS i 0,5% Tween-20. Dodano streptawidynę-HRP (100 ng / ml) (Pierce Chemical Co.) w celu ułatwienia wykrywania za pomocą substratu 3,3,5,5-tetrametylobenzydyny (Sigma-Aldrich, St. Louis, Missouri, USA). Po dodaniu roztworu zatrzymującego (Alpha Diagnostic International Inc., San Antonio, Teksas, USA), płytkę odczytywano w spektrofotometrze SpectraMax Plus (Molecular Devices Corp., Sunnyvale, Kalifornia, USA) przy 450 nm. Stężenie sFRP-4 w każdej próbce surowicy obliczono na podstawie standardowej krzywej wygenerowanej przy użyciu znanych stężeń oczyszczonego owada sFRP-4. Western blotting do wykrywania (3-ketenyny i fosforylowanej P-kateniny lub sFRP-4 w tkankach nerkowych. Nerki (około g tkanki) od szczurów nasyconych sFRP-4 lub podłożem, jak opisano powyżej, homogenizowano w równej objętości buforu (50 mM Tris, pH 7,8, 150 mM chlorek sodu) zawierającego mieszaninę inhibitorów ssaczych proteaz (P8340). Sigma-Aldrich) i inhibitory fosfatazy kwas okadaikowy (1 .M) i LR mikrocystyny (1 .M, Sigma-Aldrich). Równe ilości białka z kontroli i doświadczalnych nerek zostały załadowane i poddane elektroforezie na żelach SDS-poliakryloamidowych (31). Elektroforezowane białka przeniesiono na membrany z difluorku poliwinylidenu (32), a membrany sondowano za pomocą Ap. Przeciwko. -Keneninie lub fosforylowanej P-kateninie (Cell Signaling Technologies, Beverly, Massachusetts, USA).
[patrz też: centrum onkologii warszawa roentgena, niedobór witaminy d3 objawy u dorosłych, polana szymoszkowa basen ]
[więcej w: balsam kapucyński ulotka, pompa insulinowa refundacja, depilacja laserowa twarzy ]